PPP1R15A cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52321-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PPP1R15A Reagents

CRO Services

Product recommended


All PPP1R15A Reagents

PPP1R15A cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1974 bp
Description
Full length Clone DNA of Mouse protein phosphatase 1, regulatory (inhibitor) subunit 15A with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP1R15A cDNA ORF Clone, Mouse, N-HA tag Alternative Names

9630030H21 cDNA ORF Clone, Mouse;Gadd34 cDNA ORF Clone, Mouse;Myd116 cDNA ORF Clone, Mouse

PPP1R15A Background Information

Full Name
protein phosphatase 1, regulatory subunit 15A

PPP1R15A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP1R15A cDNA ORF Clone in Cloning Vector, Mouse MG52321-G
PPP1R15A cDNA ORF Clone, Mouse, untagged MG52321-UT
PPP1R15A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52321-ACGLN
PPP1R15A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52321-ACG
PPP1R15A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52321-ANG
PPP1R15A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52321-ACR
PPP1R15A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52321-ANR
PPP1R15A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52321-CF
PPP1R15A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52321-NF
PPP1R15A cDNA ORF Clone, Mouse, C-His tag MG52321-CH
PPP1R15A cDNA ORF Clone, Mouse, N-His tag MG52321-NH
PPP1R15A cDNA ORF Clone, Mouse, C-HA tag MG52321-CY
PPP1R15A cDNA ORF Clone, Mouse, C-Myc tag MG52321-CM
PPP1R15A cDNA ORF Clone, Mouse, N-Myc tag MG52321-NM
PPP1R15A qPCR Primer Pairs, Mouse MP202194

PPP1R15A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP1R15A cDNA ORF Clone in Cloning Vector, Human HG16601-U
PPP1R15A cDNA ORF Clone, Human, untagged HG16601-UT
PPP1R15A cDNA ORF Clone, Human, untagged HG12418-UT
PPP1R15A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12418-ACGLN
PPP1R15A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16601-ACGLN
PPP1R15A cDNA ORF Clone, Human, C-GFPSpark® tag HG16601-ACG
PPP1R15A cDNA ORF Clone, Human, C-OFPSpark® tag HG16601-ACR
PPP1R15A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16601-CF
PPP1R15A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16601-NF
PPP1R15A cDNA ORF Clone, Human, C-His tag HG16601-CH
PPP1R15A cDNA ORF Clone, Human, N-His tag HG16601-NH
PPP1R15A cDNA ORF Clone, Human, C-HA tag HG16601-CY
PPP1R15A cDNA ORF Clone, Human, N-HA tag HG16601-NY
PPP1R15A cDNA ORF Clone, Human, C-Myc tag HG16601-CM
PPP1R15A cDNA ORF Clone, Human, N-Myc tag HG16601-NM
PPP1R15A qPCR Primer Pairs, Human HP104771
info info
添加购物车成功! 添加购物车失败!