PPP1R15A cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

PPP1R15A cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1974 bp
Description
Full length Clone DNA of Mouse protein phosphatase 1, regulatory (inhibitor) subunit 15A with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PPP1R15A cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

9630030H21 cDNA ORF Clone, Mouse; Gadd34 cDNA ORF Clone, Mouse; Myd116 cDNA ORF Clone, Mouse

PPP1R15A Background Information

Full Name
protein phosphatase 1, regulatory subunit 15A
Add to Cart Successfully Add to Cart Failed