NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52638-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All NUCB2/Nucleobindin 2 Reagents

CRO Services

Product recommended


All NUCB2/Nucleobindin 2 Reagents

NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Description
Full length Clone DNA of Mouse nucleobindin 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

AI607786 cDNA ORF Clone, Mouse;Calnuc cDNA ORF Clone, Mouse;Nefa cDNA ORF Clone, Mouse;Nesfatin-1 cDNA ORF Clone, Mouse

NUCB2/Nucleobindin 2 Background Information

Full Name
nucleobindin 2

NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
NUCB2/Nucleobindin 2 cDNA ORF Clone in Cloning Vector, Ferret FG60071-G
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, untagged FG60071-UT
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60071-ACG
NUCB2/Nucleobindin 2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60071-ACGLN
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60071-ACR
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60071-CF
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60071-NF
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-His tag FG60071-CH
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, N-His tag FG60071-NH
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-HA tag FG60071-CY
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, N-HA tag FG60071-NY
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, C-Myc tag FG60071-CM
NUCB2/Nucleobindin 2 cDNA ORF Clone, Ferret, N-Myc tag FG60071-NM

NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NUCB2/Nucleobindin 2 cDNA ORF Clone in Cloning Vector, Mouse MG52638-G
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, untagged MG52638-UT
NUCB2/Nucleobindin 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52638-ACGLN
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52638-ACG
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52638-ANG
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52638-ACR
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52638-ANR
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52638-NF
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-His tag MG52638-CH
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-His tag MG52638-NH
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-HA tag MG52638-CY
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-HA tag MG52638-NY
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, C-Myc tag MG52638-CM
NUCB2/Nucleobindin 2 cDNA ORF Clone, Mouse, N-Myc tag MG52638-NM
NUCB2/Nucleobindin 2 qPCR Primer Pairs, Mouse MP202509

NUCB2/Nucleobindin 2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NUCB2/Nucleobindin 2 cDNA ORF Clone, Human, untagged HG17422-UT
info info
添加购物车成功! 添加购物车失败!