Alpha SNAP cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52854-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Alpha SNAP Reagents

CRO Services

Product recommended


All Alpha SNAP Reagents

Alpha SNAP cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Mouse N-ethylmaleimide sensitive fusion protein attachment protein alpha with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Alpha SNAP cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

1500039N14Rik cDNA ORF Clone, Mouse;a-SNAP cDNA ORF Clone, Mouse;AW209189 cDNA ORF Clone, Mouse;hyh cDNA ORF Clone, Mouse;RA81 cDNA ORF Clone, Mouse;SNAPA cDNA ORF Clone, Mouse;SNARE cDNA ORF Clone, Mouse

Alpha SNAP Background Information

NAPA represents an anti-apoptotic protein that promotes resistance to cisplatin in cancer cells by inducing the degradation of the tumor suppressor p53. Knockdown of NAPA using short-hairpin RNA was shown to induce p53 accumulation and to sensitize HEK293 cells to cisplatin. NAPA overexpression decreased the ubiquitination and degradation of synoviolin, and reduced p53 protein level.The combination of cisplatin and knockdown of NAPA represents a novel and attractive strategy to eradicate p53-sensitive cancer cells.NAPA-73 as one of the earliest neuronal markers may reflect a difference between the central and peripheral nervous systems.
Full Name
N-ethylmaleimide-sensitive factor attachment protein, alpha

Alpha SNAP cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Alpha SNAP cDNA ORF Clone in Cloning Vector, Rhesus CG90825-G
Alpha SNAP cDNA ORF Clone, Rhesus, untagged CG90825-UT
Alpha SNAP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90825-ACG
Alpha SNAP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90825-ACGLN
Alpha SNAP cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90825-ANG
Alpha SNAP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90825-ACR
Alpha SNAP cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90825-ANR
Alpha SNAP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90825-CF
Alpha SNAP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90825-NF
Alpha SNAP cDNA ORF Clone, Rhesus, C-His tag CG90825-CH
Alpha SNAP cDNA ORF Clone, Rhesus, N-His tag CG90825-NH
Alpha SNAP cDNA ORF Clone, Rhesus, C-HA tag CG90825-CY
Alpha SNAP cDNA ORF Clone, Rhesus, N-HA tag CG90825-NY
Alpha SNAP cDNA ORF Clone, Rhesus, C-Myc tag CG90825-CM
Alpha SNAP cDNA ORF Clone, Rhesus, N-Myc tag CG90825-NM

Alpha SNAP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Alpha SNAP cDNA ORF Clone in Cloning Vector, Rat RG80962-U
Alpha SNAP cDNA ORF Clone, Rat, untagged RG80962-UT
Alpha SNAP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80962-ACGLN
Alpha SNAP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80962-ACG
Alpha SNAP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80962-ANG
Alpha SNAP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80962-ACR
Alpha SNAP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80962-ANR
Alpha SNAP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80962-CF
Alpha SNAP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80962-NF
Alpha SNAP cDNA ORF Clone, Rat, C-His tag RG80962-CH
Alpha SNAP cDNA ORF Clone, Rat, N-His tag RG80962-NH
Alpha SNAP cDNA ORF Clone, Rat, C-HA tag RG80962-CY
Alpha SNAP cDNA ORF Clone, Rat, N-HA tag RG80962-NY
Alpha SNAP cDNA ORF Clone, Rat, C-Myc tag RG80962-CM
Alpha SNAP cDNA ORF Clone, Rat, N-Myc tag RG80962-NM
Alpha SNAP qPCR Primer Pairs, Rat RP300926

Alpha SNAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Alpha SNAP cDNA ORF Clone in Cloning Vector, Mouse MG52854-G
Alpha SNAP cDNA ORF Clone, Mouse, untagged MG52854-UT
Alpha SNAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52854-ACG
Alpha SNAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52854-ACGLN
Alpha SNAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52854-ANG
Alpha SNAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52854-ACR
Alpha SNAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52854-ANR
Alpha SNAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52854-CF
Alpha SNAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52854-NF
Alpha SNAP cDNA ORF Clone, Mouse, C-His tag MG52854-CH
Alpha SNAP cDNA ORF Clone, Mouse, N-His tag MG52854-NH
Alpha SNAP cDNA ORF Clone, Mouse, C-HA tag MG52854-CY
Alpha SNAP cDNA ORF Clone, Mouse, N-HA tag MG52854-NY
Alpha SNAP cDNA ORF Clone, Mouse, C-Myc tag MG52854-CM

Alpha SNAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Alpha SNAP cDNA ORF Clone in Cloning Vector, Human HG14800-G
Alpha SNAP cDNA ORF Clone, Human, untagged HG14800-UT
Alpha SNAP cDNA ORF Clone, Human, C-GFPSpark® tag HG14800-ACG
Alpha SNAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14800-ACGLN
Alpha SNAP cDNA ORF Clone, Human, C-OFPSpark® tag HG14800-ACR
Alpha SNAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14800-CF
Alpha SNAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14800-NF
Alpha SNAP cDNA ORF Clone, Human, C-His tag HG14800-CH
Alpha SNAP cDNA ORF Clone, Human, N-His tag HG14800-NH
Alpha SNAP cDNA ORF Clone, Human, C-HA tag HG14800-CY
Alpha SNAP cDNA ORF Clone, Human, N-HA tag HG14800-NY
Alpha SNAP cDNA ORF Clone, Human, C-Myc tag HG14800-CM
Alpha SNAP cDNA ORF Clone, Human, N-Myc tag HG14800-NM
Alpha SNAP qPCR Primer Pairs, Human HP103433
info info
添加购物车成功! 添加购物车失败!