CBARA1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG53033-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CBARA1 Reagents

CRO Services

Product recommended


All CBARA1 Reagents

CBARA1 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1434 bp
Description
Full length Clone DNA of Mouse mitochondrial calcium uptake 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CBARA1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

C730016L05Rik cDNA ORF Clone, Mouse;Calc cDNA ORF Clone, Mouse;Cbara1 cDNA ORF Clone, Mouse

CBARA1 Background Information

Full Name
mitochondrial calcium uptake 1

CBARA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Rat RG87873-U
CBARA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87873-ACGLN

CBARA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Mouse MG53033-G
CBARA1 cDNA ORF Clone, Mouse, untagged MG53033-UT
CBARA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53033-ACGLN
CBARA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53033-ACG
CBARA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53033-ANG
CBARA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53033-ACR
CBARA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53033-ANR
CBARA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53033-CF
CBARA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53033-NF
CBARA1 cDNA ORF Clone, Mouse, C-His tag MG53033-CH
CBARA1 cDNA ORF Clone, Mouse, N-His tag MG53033-NH
CBARA1 cDNA ORF Clone, Mouse, C-HA tag MG53033-CY
CBARA1 cDNA ORF Clone, Mouse, N-HA tag MG53033-NY
CBARA1 cDNA ORF Clone, Mouse, N-Myc tag MG53033-NM

CBARA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Human HG20983-U
CBARA1 cDNA ORF Clone in Cloning Vector, Human HG13567-G
CBARA1 cDNA ORF Clone, Human, untagged HG13567-UT
CBARA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20983-ACGLN
CBARA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13567-ACG
CBARA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13567-ACGLN
CBARA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13567-ANG
CBARA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13567-ACR
CBARA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13567-ANR
CBARA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13567-CF
CBARA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13567-NF
CBARA1 cDNA ORF Clone, Human, C-His tag HG13567-CH
CBARA1 cDNA ORF Clone, Human, N-His tag HG13567-NH
CBARA1 cDNA ORF Clone, Human, C-HA tag HG13567-CY
CBARA1 cDNA ORF Clone, Human, N-HA tag HG13567-NY
CBARA1 cDNA ORF Clone, Human, C-Myc tag HG13567-CM
CBARA1 cDNA ORF Clone, Human, N-Myc tag HG13567-NM
CBARA1 qPCR Primer Pairs, Human HP102253
info info
添加购物车成功! 添加购物车失败!