Schnelle Bestellung

Maus MDM2 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus MDM2 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_010786.3
    cDNA-Größe:1470bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus transformed mouse 3T3 cell double minute 2 with N terminal HA tag.
    Synonyme für Gene:Mdm-2, AA415488, 1700007J15Rik, Mdm2
    Spezies:Mouse
    Vektor:pCMV3-N-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDM2 qPCR primers for gene expression analysis, MP200525 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Hintergrund

    MDM2 gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referenzen
  • Zhuo X, Ye H, Li Q, Xiang Z, Zhang X. Is MDM2 SNP309 Variation a Risk Factor for Head and Neck Carcinoma?: An Updated Meta-Analysis Based on 11,552 Individuals. Langevin. S, ed. Medicine. 2016;95(9):e2948.
  • Size / Price
    Katalog: MG50533-NY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“