Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1743 bp
Description
Full length Clone DNA of Mouse keratin 5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

3300001P10Rik cDNA ORF Clone, Mouse; AW146334 cDNA ORF Clone, Mouse; CK5 cDNA ORF Clone, Mouse; K5 cDNA ORF Clone, Mouse; Krt2-5 cDNA ORF Clone, Mouse; Tfip8 cDNA ORF Clone, Mouse

Cytokeratin 5 Background Information

Keratin 5 is the major type II keratin of the basal cells of epidermis and of other stratified epithelia. With its type I partner, keratin 14, it constitutes a major fraction of the cytoskeleton of the basal cells. Epidermolysis bullosa simplex with mottled pigmentation (EBS-MP) is a rare dermatologic disorder of autosomal dominant inheritance with intraepidermal blistering after minor trauma, reticular hyperpigmentation unrelated to the blistering, nail dystrophy, and mild palmoplantar keratosis. Keratin 5 and keratin 14 are known to be essential for the basal keratinocyte cytoskeleton and are defective in several forms of epidermolysis bullosa simplex. Recently, a 71C-->T transition in the keratin 5 gene (KRT5) causing a P24L substitution was identified in some patients with EBS-MP.
Full Name
keratin 5, type II
Add to Cart Successfully Add to Cart Failed