After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus HDAC8 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse HDAC8 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_027382.3
cDNA-Größe:1134bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus histone deacetylase 8.
Synonyme für Gene:2610007D20Rik
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

Referenzen
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Katalog: MG50273-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“