GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Mouse glutathione synthetase.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged: Alternative Names

AI314904 cDNA ORF Clone, Mouse; GS-A/GS-B cDNA ORF Clone, Mouse; GSH-S cDNA ORF Clone, Mouse

GSS/Glutathione Synthetase Background Information

Glutathione synthetase deficiency (GSSD) is a rare inborn error of glutathione metabolism with autosomal recessive inheritance. The severe form of the disease is characterized by acute metabolic acidosis, usually present in the neonatal period with hemolytic anemia and progressive encephalopathy.
Full Name
glutathione synthetase

GSS/Glutathione Synthetase cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed