GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged

Cat: MG52240-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GSS/Glutathione Synthetase Reagents

CRO Services

Product recommended


All GSS/Glutathione Synthetase Reagents

GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Mouse glutathione synthetase.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, untagged Alternative Names

AI314904 cDNA ORF Clone, Mouse;GS-A/GS-B cDNA ORF Clone, Mouse;GSH-S cDNA ORF Clone, Mouse

GSS/Glutathione Synthetase Background Information

Full Name
glutathione synthetase

GSS/Glutathione Synthetase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSS/Glutathione Synthetase cDNA ORF Clone in Cloning Vector, Rat RG81476-G

GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSS/Glutathione Synthetase cDNA ORF Clone in Cloning Vector, Mouse MG52240-U
GSS/Glutathione Synthetase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52240-ACGLN
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52240-ACG
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52240-ANG
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52240-ACR
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52240-ANR
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52240-CF
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52240-NF
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-His tag MG52240-CH
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-His tag MG52240-NH
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-HA tag MG52240-CY
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-HA tag MG52240-NY
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, C-Myc tag MG52240-CM
GSS/Glutathione Synthetase cDNA ORF Clone, Mouse, N-Myc tag MG52240-NM
GSS/Glutathione Synthetase qPCR Primer Pairs, Mouse MP202113

GSS/Glutathione Synthetase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSS/Glutathione Synthetase cDNA ORF Clone in Cloning Vector, Human HG14830-G
GSS/Glutathione Synthetase cDNA ORF Clone, Human, untagged HG14830-UT
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-GFPSpark® tag HG14830-ACG
GSS/Glutathione Synthetase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14830-ACGLN
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-GFPSpark® tag HG14830-ANG
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-OFPSpark® tag HG14830-ACR
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-OFPSpark® tag HG14830-ANR
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14830-CF
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14830-NF
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-His tag HG14830-CH
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-His tag HG14830-NH
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-HA tag HG14830-CY
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-HA tag HG14830-NY
GSS/Glutathione Synthetase cDNA ORF Clone, Human, C-Myc tag HG14830-CM
GSS/Glutathione Synthetase cDNA ORF Clone, Human, N-Myc tag HG14830-NM
GSS/Glutathione Synthetase qPCR Primer Pairs, Human HP103461
info info
添加购物车成功! 添加购物车失败!