GPT cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52487-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GPT Reagents

CRO Services

Product recommended


All GPT Reagents

GPT cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1491 bp
Description
Full length Clone DNA of Mouse glutamic pyruvic transaminase, soluble with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPT cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

1300007J06Rik cDNA ORF Clone, Mouse;2310022B03Rik cDNA ORF Clone, Mouse;ALT cDNA ORF Clone, Mouse;Gpt-1 cDNA ORF Clone, Mouse;Gpt1 cDNA ORF Clone, Mouse

GPT Background Information

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (GPT), is a pyridoxal enzyme which belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family, Alanine aminotransferase subfamily. Gpt / Gpt1 / ALT catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. Gpt / Gpt1 / ALT is expressed in Liver, kidney, heart, and skeletal muscles and it expresses at moderate levels in the adipose tissue. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. GPT1/GPT is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis.
Full Name
glutamic-pyruvate transaminase (alanine aminotransferase)
References
  • Bergmeyer HU, et al. (1978) Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin Chem. 24(1): 58-73.
  • King MC, et al. (1980) Allele increasing susceptibility to human breast cancer may be linked to the glutamate-pyruvate transaminase locus. Science. 208(4442): 406-8.
  • Prati D, et al. (2002) Updated definitions of healthy ranges for serum alanine aminotransferase levels. Ann Intern Med. 137(1): 1-10.
  • GPT cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GPT cDNA ORF Clone in Cloning Vector, Rat RG80001-M
    GPT cDNA ORF Clone, Rat, untagged RG80001-UT
    GPT cDNA ORF Clone, Rat, C-GFPSpark® tag RG80001-ACG
    GPT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80001-ACGLN
    GPT cDNA ORF Clone, Rat, N-GFPSpark® tag RG80001-ANG
    GPT cDNA ORF Clone, Rat, C-OFPSpark® tag RG80001-ACR
    GPT cDNA ORF Clone, Rat, N-OFPSpark® tag RG80001-ANR
    GPT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80001-CF
    GPT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80001-NF
    GPT cDNA ORF Clone, Rat, C-His tag RG80001-CH
    GPT cDNA ORF Clone, Rat, N-His tag RG80001-NH
    GPT cDNA ORF Clone, Rat, C-HA tag RG80001-CY
    GPT cDNA ORF Clone, Rat, N-HA tag RG80001-NY
    GPT cDNA ORF Clone, Rat, C-Myc tag RG80001-CM
    GPT cDNA ORF Clone, Rat, N-Myc tag RG80001-NM
    GPT qPCR Primer Pairs, Rat RP300001

    GPT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GPT cDNA ORF Clone in Cloning Vector, Mouse MG52487-U
    GPT cDNA ORF Clone, Mouse, untagged MG52487-UT
    GPT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52487-ACG
    GPT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52487-ACGLN
    GPT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52487-ANG
    GPT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52487-ACR
    GPT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52487-ANR
    GPT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52487-CF
    GPT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52487-NF
    GPT cDNA ORF Clone, Mouse, C-His tag MG52487-CH
    GPT cDNA ORF Clone, Mouse, N-His tag MG52487-NH
    GPT cDNA ORF Clone, Mouse, C-HA tag MG52487-CY
    GPT cDNA ORF Clone, Mouse, N-HA tag MG52487-NY
    GPT cDNA ORF Clone, Mouse, N-Myc tag MG52487-NM
    GPT qPCR Primer Pairs, Mouse MP202360

    GPT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPT cDNA ORF Clone, Human, untagged HG17947-UT
    info info
    添加购物车成功! 添加购物车失败!