Glypican 3 cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

Glypican 3 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1740 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glypican 3.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.74kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Glypican 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glypican 3 cDNA ORF Clone, Mouse, untagged: Validated Images

Glypican 3 cDNA ORF Clone, Mouse, untagged: Alternative Names

OCI-5 cDNA ORF Clone, Mouse

Glypican 3 Background Information

Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.Immune CheckpointImmunotherapyCancer ImmunotherapyTargeted Therapy
Full Name
glypican 3
References
  • Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.
  • Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.
Add to Cart Successfully Add to Cart Failed