After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus glutaredoxin-1 / GRX1 / GLRX Gene ORF cDNA clone expression plasmid, N-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse GLRX Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_053108.4
cDNA-Größe:324bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus glutaredoxin with N terminal Flag tag.
Synonyme für Gene:Grx1, Glrx1, TTase, C86710, D13Wsu156e
Spezies:Mouse
Vektor:pCMV3-N-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Maus glutaredoxin-1 / GRX1 / GLRX Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Product nameProduct name
Hintergrund

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

Referenzen
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Katalog: MG52947-NF
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“