After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse GART Produktinformation zum cDNA-Klon
Gene_bank_ref_id:AK168445.1
cDNA-Größe:1302bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus phosphoribosylglycinamide formyltransferase with C terminal His tag.
Synonyme für Gene:Gaps, Prgs
Spezies:Mouse
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52285-ACG$225
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52285-ACR$225
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52285-ANG$225
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52285-ANR$225
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-Flag tagMG52285-CF$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tagMG52285-CH$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-Myc tagMG52285-CM$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-HA tagMG52285-CY$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone in cloning vectorMG52285-G$75
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-Flag tagMG52285-NF$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-His tagMG52285-NH$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-Myc tagMG52285-NM$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-HA tagMG52285-NY$195
Maus GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmidMG52285-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: MG52285-CH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“