Schnelle Bestellung

Maus FLT3L / Flt3 ligand Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse FLT3LG Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_013520.3
cDNA-Größe:699bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus FMS-like tyrosine kinase 3 ligand with C terminal HA tag.
Synonyme für Gene:Ly72L, Flt3lg
Spezies:Mouse
Vektor:pCMV3-C-HA
Plasmid:pCMV3-mFLT3LG-HA
Restriktionsschnittstelle:KpnI + XbaI (6kb + 0.74kb)
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FLT3LG Gene Plasmid Map
Mouse FLT3L natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Hintergrund

FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases the number of immune cells by activating the hematopoietic progenitors. In vivo, FLT3L also induces the mobilization of the hematopoietic progenitors and stem cells. This may help the system to kill cancer cells. Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3L controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 -positive classical DCs and their CD103 -positive tissue counterparts.

Referenzen
  • Hannum C, et al. (1994) Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368 (6472): 643-8.
  • Lyman SD, et al. (1995) Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs. Oncogene 10 (1): 149-57.
  • Lyman SD, et al. (1994) Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75 (6): 1157-67.
  • Size / Price
    Katalog: MG51113-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Mouse FLT3L natural ORF mammalian expression plasmid, C-HA tag
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“