After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Maus FLRT2 Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse FLRT2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_201518.4
cDNA-Größe:1983bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus fibronectin leucine rich transmembrane protein 2 with C terminal His tag.
Synonyme für Gene:KIAA0405, Flrt2
Spezies:Mouse
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

Fibronectin Leucine-Rich Transmembrane (FLRT) proteins are glycosylated membrane proteins expressed at the cell surface which localise in a homophilic manner to cell-cell contacts expressing the focal adhesion marker vinculin. FLRT1, FLRT2, and FLRT3, the three genes encode putative type I transmembrane proteins, each containing 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT family members may function in cell adhesion and/or receptor signalling. Each member of the FLRT family has a distinct, highly regulated expression pattern, as was seen for the NLRR family. FLRT2 is expressed in a subset of the sclerotome, adjacent to the region that forms the syndetome, suggesting that interaction with FGF signalling may be a general property of FLRT proteins. All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. FLRT proteins have a dual role, promoting FGF signalling and modulating homotypic cell adhesion. FLRT2 played critical roles in craniofacial development, and it was also present in the vomero-nasal organ, mandibular primodia, and the posterior aspects of the unfused and fused secondary palatal shelves.

Referenzen
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 9(7): 497-502.
  • Size / Price
    Katalog: MG51074-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“