Schnelle Bestellung

Maus FBXO9 Gene ORF cDNA clone expression plasmid, C-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus FBXO9 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_023605.2
    cDNA-Größe:1311bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus f-box protein 9 with C terminal His tag.
    Synonyme für Gene:AA986398, 9030401P18Rik
    Spezies:Mouse
    Vektor:pCMV3-C-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FBXO9 qPCR primers for gene expression analysis, MP201581 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Size / Price
    Katalog: MG51708-CH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“