EphB4 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50582-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EphB4 Reagents

CRO Services

Product recommended


All EphB4 Reagents

EphB4 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2964 bp
Description
Full length Clone DNA of Mouse Eph receptor B4 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB4 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI042935 cDNA ORF Clone, Mouse;Htk cDNA ORF Clone, Mouse;MDK2 cDNA ORF Clone, Mouse;Myk1 cDNA ORF Clone, Mouse;Tyro11 cDNA ORF Clone, Mouse

EphB4 Background Information

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.
Full Name
EPH receptor B4
References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
  • EphB4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphB4 cDNA ORF Clone in Cloning Vector, Mouse MG50582-M
    EphB4 cDNA ORF Clone, Mouse, untagged MG50582-UT
    EphB4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50582-ACGLN
    EphB4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50582-ACG
    EphB4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50582-ACR
    EphB4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50582-CF
    EphB4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50582-NF
    EphB4 cDNA ORF Clone, Mouse, C-His tag MG50582-CH
    EphB4 cDNA ORF Clone, Mouse, C-HA tag MG50582-CY
    EphB4 cDNA ORF Clone, Mouse, N-HA tag MG50582-NY
    EphB4 cDNA ORF Clone, Mouse, C-Myc tag MG50582-CM
    EphB4 cDNA ORF Clone, Mouse, N-Myc tag MG50582-NM
    EphB4 qPCR Primer Pairs, Mouse MP200574

    EphB4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphB4 cDNA ORF Clone in Cloning Vector, Human HG10235-M
    EphB4 cDNA ORF Clone, Human, untagged HG10235-UT
    EphB4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10235-ACG
    EphB4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10235-ACGLN
    EphB4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10235-ACR
    EphB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10235-CF
    EphB4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10235-NF
    EphB4 cDNA ORF Clone, Human, C-His tag HG10235-CH
    EphB4 cDNA ORF Clone, Human, N-His tag HG10235-NH
    EphB4 cDNA ORF Clone, Human, C-HA tag HG10235-CY
    EphB4 cDNA ORF Clone, Human, N-HA tag HG10235-NY
    EphB4 cDNA ORF Clone, Human, C-Myc tag HG10235-CM
    EphB4 cDNA ORF Clone, Human, N-Myc tag HG10235-NM
    EphB4 qPCR Primer Pairs, Human HP100066
    info info
    添加购物车成功! 添加购物车失败!