Schnelle Bestellung

Maus ENTPD3 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Maus ENTPD3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_178676.3
cDNA-Größe:1590bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 3.
Synonyme für Gene:HB6, Cd39l3, NTPDase-3, 6330566B20, Entpd3
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ENTPD3 qPCR primers for gene expression analysis, MP200294 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referenzen
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • Size / Price
    Katalog: MG50269-UT
    Listenpreis: 
    Preis:      (You Save: )
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“