Argonaute-2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50683-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Argonaute-2 Reagents

CRO Services

Product recommended


All Argonaute-2 Reagents

Argonaute-2 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2583 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 2C, 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About Argonaute-2

Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Argonaute-2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

1110029L17Rik cDNA ORF Clone, Mouse;2310051F07Rik cDNA ORF Clone, Mouse;AI225898 cDNA ORF Clone, Mouse;AL022874 cDNA ORF Clone, Mouse;AW546247 cDNA ORF Clone, Mouse;Eif2c2 cDNA ORF Clone, Mouse;ENSMUSG00000072493 cDNA ORF Clone, Mouse;Gerp95 cDNA ORF Clone, Mouse;Gm10365 cDNA ORF Clone, Mouse;mKIAA4215 cDNA ORF Clone, Mouse

Argonaute-2 Background Information

Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family, AGO subfamily, which is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. AGO2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Human AGO2 was unable to cleave preformed RNA duplexes and exhibited weaker binding affinity for RNA duplexes compared with the single strand RNA. The enzyme exhibited greater RNase H activity in the presence of Mn2+ compared with Mg2+. Human AGO2 exhibited weaker binding affinities and reduced cleavage activities for antisense RNAs with either a 5'-terminal hydroxyl or abasic nucleotide. In mouse hematopoiesis, AGO2 controls early development of lymphoid and erythroid cells. AGO2 is a highly specialized member of the Argonaute family with an essential nonredundant Slicer-independent function within the mammalian miRNA pathway. AGO2 regulates dFMR1 expression, and the relationship between dFMR1 and AGO2 was defined by their physical interaction and co-regulation of downstream targets. AGO2 and dFMR1 are also connected through a regulatory relationship. AGO2 is a regulator of dFMR1 expression and have clarified an important developmental role for AGO2 in the nervous system and germ line that requires dFMR1 function. In addition, AGO2 is regulated at both the transcriptional and posttranslational level, and also implicate AGO2 and enhanced micro-RNA activity in the tumorigenic progression of breast cancer cell lines.

Full Name
argonaute RISC catalytic component 2
References
  • O'Carroll D, et al. (2007) A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 21(16): 1999-2004.
  • Pepper AS, et al. (2009) Argonaute2 suppresses Drosophila fragile X expression preventing neurogenesis and oogenesis defects. PLoS One. 4(10): e7618.
  • Lima WF, et al. (2009) Binding and cleavage specificities of human Argonaute2. J Biol Chem. 284(38): 26017-28.
  • Adams BD, et al. (2009) Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells. Endocrinology. 150(1): 14-23.
  • Salvatore V, et al. (2010) Bacterial expression of mouse argonaute 2 for functional and mutational studies. Int J Mol Sci. 11(2): 745-53.
  • Wilson JA, et al. (2011) Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. J Virol. 85(5): 2342-50.
  • Argonaute-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Argonaute-2 cDNA ORF Clone in Cloning Vector, Mouse MG50683-M
    Argonaute-2 cDNA ORF Clone, Mouse, untagged MG50683-UT
    Argonaute-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50683-ACG
    Argonaute-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50683-ACGLN
    Argonaute-2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50683-ANG
    Argonaute-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50683-ACR
    Argonaute-2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50683-ANR
    Argonaute-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50683-CF
    Argonaute-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50683-NF
    Argonaute-2 cDNA ORF Clone, Mouse, C-His tag MG50683-CH
    Argonaute-2 cDNA ORF Clone, Mouse, N-His tag MG50683-NH
    Argonaute-2 cDNA ORF Clone, Mouse, C-HA tag MG50683-CY
    Argonaute-2 cDNA ORF Clone, Mouse, N-HA tag MG50683-NY
    Argonaute-2 cDNA ORF Clone, Mouse, N-Myc tag MG50683-NM
    Argonaute-2 qPCR Primer Pairs, Mouse MP200661

    Argonaute-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Argonaute-2 cDNA ORF Clone in Cloning Vector, Human HG11079-M
    Argonaute-2 cDNA ORF Clone, Human, untagged HG11079-UT
    Argonaute-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11079-ACG
    Argonaute-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11079-ACGLN
    Argonaute-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11079-ANG
    Argonaute-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11079-ACR
    Argonaute-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11079-ANR
    Argonaute-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11079-CF
    Argonaute-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11079-NF
    Argonaute-2 cDNA ORF Clone, Human, C-His tag HG11079-CH
    Argonaute-2 cDNA ORF Clone, Human, N-His tag HG11079-NH
    Argonaute-2 cDNA ORF Clone, Human, C-HA tag HG11079-CY
    Argonaute-2 cDNA ORF Clone, Human, N-HA tag HG11079-NY
    Argonaute-2 cDNA ORF Clone, Human, C-Myc tag HG11079-CM
    Argonaute-2 cDNA ORF Clone, Human, N-Myc tag HG11079-NM
    Argonaute-2 qPCR Primer Pairs, Human HP101001
    info info
    添加购物车成功! 添加购物车失败!