CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) receptor 4 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

b2b220Clo cDNA ORF Clone, Mouse; CD184 cDNA ORF Clone, Mouse; Cmkar4 cDNA ORF Clone, Mouse; LESTR cDNA ORF Clone, Mouse; PB-CKR cDNA ORF Clone, Mouse; PBSF/SDF-1 cDNA ORF Clone, Mouse; Sdf1r cDNA ORF Clone, Mouse

CXCR4/CD184 Background Information

Full Name
chemokine (C-X-C motif) receptor 4
Research Areas

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed