CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag

Cat: MG50621-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CXCR4/CD184 Reagents

CRO Services

Product recommended


All CXCR4/CD184 Reagents

CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Mouse chemokine (C-X-C motif) receptor 4 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR4/CD184 cDNA ORF Clone, Mouse, C-His tag Alternative Names

b2b220Clo cDNA ORF Clone, Mouse;CD184 cDNA ORF Clone, Mouse;Cmkar4 cDNA ORF Clone, Mouse;LESTR cDNA ORF Clone, Mouse;PB-CKR cDNA ORF Clone, Mouse;PBSF/SDF-1 cDNA ORF Clone, Mouse;Sdf1r cDNA ORF Clone, Mouse

CXCR4/CD184 Background Information

Full Name
chemokine (C-X-C motif) receptor 4
Research Areas

CXCR4/CD184 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CXCR4/CD184 cDNA ORF Clone in Cloning Vector, Rhesus CG90232-G
CXCR4/CD184 cDNA ORF Clone, Rhesus, untagged CG90232-UT
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90232-ACG
CXCR4/CD184 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90232-ACGLN
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90232-ACR
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90232-CF
CXCR4/CD184 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90232-NF
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-His tag CG90232-CH
CXCR4/CD184 cDNA ORF Clone, Rhesus, N-His tag CG90232-NH
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-HA tag CG90232-CY
CXCR4/CD184 cDNA ORF Clone, Rhesus, N-HA tag CG90232-NY
CXCR4/CD184 cDNA ORF Clone, Rhesus, C-Myc tag CG90232-CM
CXCR4/CD184 cDNA ORF Clone, Rhesus, N-Myc tag CG90232-NM

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
CXCR4/CD184 cDNA ORF Clone, Cynomolgus, untagged CG90898-UT

CXCR4/CD184 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CXCR4/CD184 cDNA ORF Clone in Cloning Vector, Rat RG80342-G
CXCR4/CD184 cDNA ORF Clone, Rat, untagged RG80342-UT
CXCR4/CD184 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80342-ACG
CXCR4/CD184 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80342-ACGLN
CXCR4/CD184 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80342-ANG
CXCR4/CD184 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80342-ACR
CXCR4/CD184 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80342-CF
CXCR4/CD184 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80342-NF
CXCR4/CD184 cDNA ORF Clone, Rat, C-His tag RG80342-CH
CXCR4/CD184 cDNA ORF Clone, Rat, N-His tag RG80342-NH
CXCR4/CD184 cDNA ORF Clone, Rat, C-HA tag RG80342-CY
CXCR4/CD184 cDNA ORF Clone, Rat, N-HA tag RG80342-NY
CXCR4/CD184 cDNA ORF Clone, Rat, C-Myc tag RG80342-CM
CXCR4/CD184 cDNA ORF Clone, Rat, N-Myc tag RG80342-NM
CXCR4/CD184 qPCR Primer Pairs, Rat RP300312

CXCR4/CD184 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCR4/CD184 cDNA ORF Clone in Cloning Vector, Mouse MG50621-M
CXCR4/CD184 cDNA ORF Clone, Mouse, untagged MG50621-UT
CXCR4/CD184 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50621-ACG
CXCR4/CD184 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50621-ACGLN
CXCR4/CD184 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50621-ACR
CXCR4/CD184 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50621-CF
CXCR4/CD184 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50621-NF
CXCR4/CD184 cDNA ORF Clone, Mouse, N-His tag MG50621-NH
CXCR4/CD184 cDNA ORF Clone, Mouse, C-HA tag MG50621-CY
CXCR4/CD184 cDNA ORF Clone, Mouse, N-HA tag MG50621-NY
CXCR4/CD184 cDNA ORF Clone, Mouse, C-Myc tag MG50621-CM
CXCR4/CD184 cDNA ORF Clone, Mouse, N-Myc tag MG50621-NM
CXCR4/CD184 qPCR Primer Pairs, Mouse MP200606

CXCR4/CD184 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CXCR4/CD184 cDNA ORF Clone in Cloning Vector, Human HG11325-M
CXCR4/CD184 cDNA ORF Clone, Human, untagged HG11325-UT
CXCR4/CD184 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11325-ACGLN
CXCR4/CD184 cDNA ORF Clone, Human, C-GFPSpark® tag HG11325-ACG
CXCR4/CD184 cDNA ORF Clone, Human, N-GFPSpark® tag HG11325-ANG
CXCR4/CD184 cDNA ORF Clone, Human, C-OFPSpark® tag HG11325-ACR
CXCR4/CD184 cDNA ORF Clone, Human, N-OFPSpark® tag HG11325-ANR
CXCR4/CD184 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11325-CF
CXCR4/CD184 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11325-NF
CXCR4/CD184 cDNA ORF Clone, Human, C-His tag HG11325-CH
CXCR4/CD184 cDNA ORF Clone, Human, N-His tag HG11325-NH
CXCR4/CD184 cDNA ORF Clone, Human, C-HA tag HG11325-CY
CXCR4/CD184 cDNA ORF Clone, Human, N-HA tag HG11325-NY
CXCR4/CD184 cDNA ORF Clone, Human, C-Myc tag HG11325-CM
CXCR4/CD184 cDNA ORF Clone, Human, N-Myc tag HG11325-NM
CXCR4/CD184 qPCR Primer Pairs, Human HP101210
info info
添加购物车成功! 添加购物车失败!