CSRP1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CSRP1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Mouse cysteine and glycine-rich protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CSRP1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

AA408841 cDNA ORF Clone, Mouse; AA959891 cDNA ORF Clone, Mouse; AW545626 cDNA ORF Clone, Mouse; CRP1 cDNA ORF Clone, Mouse; Csrp cDNA ORF Clone, Mouse

CSRP1 Background Information

Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains twoLIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.
Full Name
cysteine and glycine-rich protein 1
References
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后