CRABP2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50535-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CRABP2 Reagents

CRO Services

Product recommended


All CRABP2 Reagents

CRABP2 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
417 bp
Description
Full length Clone DNA of Mouse cellular retinoic acid binding protein II with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRABP2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AI893628 cDNA ORF Clone, Mouse;Crabp-2 cDNA ORF Clone, Mouse;CrabpII cDNA ORF Clone, Mouse

CRABP2 Background Information

Cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.
Full Name
cellular retinoic acid binding protein 2
References
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • CRABP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CRABP2 cDNA ORF Clone in Cloning Vector, Mouse MG50535-M
    CRABP2 cDNA ORF Clone, Mouse, untagged MG50535-UT
    CRABP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50535-ACGLN
    CRABP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50535-ACG
    CRABP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50535-ANG
    CRABP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50535-ACR
    CRABP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50535-ANR
    CRABP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50535-CF
    CRABP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50535-NF
    CRABP2 cDNA ORF Clone, Mouse, C-His tag MG50535-CH
    CRABP2 cDNA ORF Clone, Mouse, N-His tag MG50535-NH
    CRABP2 cDNA ORF Clone, Mouse, C-HA tag MG50535-CY
    CRABP2 cDNA ORF Clone, Mouse, N-HA tag MG50535-NY
    CRABP2 cDNA ORF Clone, Mouse, C-Myc tag MG50535-CM
    CRABP2 qPCR Primer Pairs, Mouse MP200527

    CRABP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CRABP2 cDNA ORF Clone in Cloning Vector, Human HG11203-M
    CRABP2 cDNA ORF Clone, Human, untagged HG11203-UT
    CRABP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11203-ACGLN
    CRABP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11203-ACG
    CRABP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11203-ANG
    CRABP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11203-ACR
    CRABP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11203-ANR
    CRABP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11203-CF
    CRABP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11203-NF
    CRABP2 cDNA ORF Clone, Human, C-His tag HG11203-CH
    CRABP2 cDNA ORF Clone, Human, N-His tag HG11203-NH
    CRABP2 cDNA ORF Clone, Human, C-HA tag HG11203-CY
    CRABP2 cDNA ORF Clone, Human, N-HA tag HG11203-NY
    CRABP2 cDNA ORF Clone, Human, C-Myc tag HG11203-CM
    CRABP2 cDNA ORF Clone, Human, N-Myc tag HG11203-NM
    CRABP2 qPCR Primer Pairs, Human HP100071
    info info
    添加购物车成功! 添加购物车失败!