Schnelle Bestellung

Maus COX7A2L Gene ORF cDNA clone expression plasmid

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus COX7A2L Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_009187.3
    cDNA-Größe:336bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit VIIa polypeptide 2-like.
    Synonyme für Gene:EB1, SIG81, COX7AR, COX7RP, SIG-81, Silg81
    Spezies:Mouse
    Vektor:pCMV3-untagged
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COX7A2L qPCR primers for gene expression analysis, MP201226 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Size / Price
    Katalog: MG51349-UT
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“