COQ7 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50969-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All COQ7 Reagents

CRO Services

Product recommended


All COQ7 Reagents

COQ7 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Mouse demethyl-Q 7 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COQ7 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

clk-1 cDNA ORF Clone, Mouse

COQ7 Background Information

Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.
Full Name
coenzyme Q7 homolog, ubiquinone (yeast)
References
  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • COQ7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    COQ7 cDNA ORF Clone in Cloning Vector, Rat RG80718-U
    COQ7 cDNA ORF Clone, Rat, untagged RG80718-UT
    COQ7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80718-ACG
    COQ7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80718-ACGLN
    COQ7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80718-ANG
    COQ7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80718-ACR
    COQ7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80718-ANR
    COQ7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80718-CF
    COQ7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80718-NF
    COQ7 cDNA ORF Clone, Rat, C-His tag RG80718-CH
    COQ7 cDNA ORF Clone, Rat, N-His tag RG80718-NH
    COQ7 cDNA ORF Clone, Rat, C-HA tag RG80718-CY
    COQ7 cDNA ORF Clone, Rat, N-HA tag RG80718-NY
    COQ7 cDNA ORF Clone, Rat, C-Myc tag RG80718-CM
    COQ7 cDNA ORF Clone, Rat, N-Myc tag RG80718-NM
    COQ7 qPCR Primer Pairs, Rat RP300682

    COQ7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    COQ7 cDNA ORF Clone in Cloning Vector, Mouse MG50969-G
    COQ7 cDNA ORF Clone, Mouse, untagged MG50969-UT
    COQ7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50969-ACG
    COQ7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50969-ACGLN
    COQ7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50969-ANG
    COQ7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50969-ACR
    COQ7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50969-ANR
    COQ7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50969-CF
    COQ7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50969-NF
    COQ7 cDNA ORF Clone, Mouse, C-His tag MG50969-CH
    COQ7 cDNA ORF Clone, Mouse, N-His tag MG50969-NH
    COQ7 cDNA ORF Clone, Mouse, N-HA tag MG50969-NY
    COQ7 cDNA ORF Clone, Mouse, C-Myc tag MG50969-CM
    COQ7 cDNA ORF Clone, Mouse, N-Myc tag MG50969-NM
    COQ7 qPCR Primer Pairs, Mouse MP200938

    COQ7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    COQ7 cDNA ORF Clone in Cloning Vector, Human HG12195-G
    COQ7 cDNA ORF Clone, Human, untagged HG12195-UT
    COQ7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12195-ACG
    COQ7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12195-ACGLN
    COQ7 cDNA ORF Clone, Human, N-GFPSpark® tag HG12195-ANG
    COQ7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12195-ACR
    COQ7 cDNA ORF Clone, Human, N-OFPSpark® tag HG12195-ANR
    COQ7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12195-CF
    COQ7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12195-NF
    COQ7 cDNA ORF Clone, Human, C-His tag HG12195-CH
    COQ7 cDNA ORF Clone, Human, N-His tag HG12195-NH
    COQ7 cDNA ORF Clone, Human, C-HA tag HG12195-CY
    COQ7 cDNA ORF Clone, Human, N-HA tag HG12195-NY
    COQ7 cDNA ORF Clone, Human, C-Myc tag HG12195-CM
    COQ7 cDNA ORF Clone, Human, N-Myc tag HG12195-NM
    COQ7 qPCR Primer Pairs, Human HP101841
    info info
    添加购物车成功! 添加购物车失败!