After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus CKB / Creatine kinase B type Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse CKB Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_021273.4
cDNA-Größe:1146bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus creatine kinase, brain.
Synonyme für Gene:Bck, Ck3, B-CK, Ck-3, Ckbb
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Referenzen
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Katalog: MG51386-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“