Schnelle Bestellung

Text Size:AAA

Maus CIB2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse CIB2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC005739.1
cDNA-Größe:564bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus calcium and integrin binding family member 2 with N terminal Myc tag.
Synonyme für Gene:AI449053, 2810434I23Rik
Spezies:Mouse
Vektor:pCMV3-N-Myc
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Referenzen
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
  • Size / Price
    Katalog: MG52594-NM
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“