CEL cDNA ORF Clone, Mouse, N-His tag

Cat: MG50583-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CEL Reagents

CRO Services

Product recommended


All CEL Reagents

CEL cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1800 bp
Description
Full length Clone DNA of Mouse BAL; 1810036E18Rik; Cel with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEL cDNA ORF Clone, Mouse, N-His tag Alternative Names

1810036E18Rik cDNA ORF Clone, Mouse;BAL cDNA ORF Clone, Mouse

CEL Background Information

CEL-maturity onset diabetes of the young (MODY), diabetes with pancreatic lipomatosis and exocrine dysfunction, is due to dominant frameshift mutations in the acinar cell carboxyl ester lipase gene (CEL). Bile-salt activated carboxylic ester lipase (CEL) is a major triglyceride, cholesterol ester and vitamin ester hydrolytic enzyme contained within pancreatic and lactating mammary gland secretions. Carboxyl ester lipase is a digestive pancreatic enzyme encoded by the CEL gene. Mutations in CEL cause maturity-onset diabetes of the young as well as pancreatic exocrine dysfunction. The enzyme carboxyl ester lipase (CEL), also known as bile salt-dependent or -stimulated lipase (BSDL, BSSL), hydrolyzes dietary fat, cholesteryl esters and fat-soluble vitamins in the duodenum. CEL is mainly expressed in pancreatic acinar cells and lactating mammary glands. The human CEL gene resides on chromosome 9q34.3 and contains a variable number of tandem repeats (VNTR) region that encodes a mucin-like protein tail.
Full Name
carboxyl ester lipase

CEL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone in Cloning Vector, Rat RG81233-U
CEL cDNA ORF Clone, Rat, untagged RG81233-UT
CEL cDNA ORF Clone, Rat, C-GFPSpark® tag RG81233-ACG
CEL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81233-ACGLN
CEL cDNA ORF Clone, Rat, C-OFPSpark® tag RG81233-ACR
CEL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81233-CF
CEL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81233-NF
CEL cDNA ORF Clone, Rat, C-His tag RG81233-CH
CEL cDNA ORF Clone, Rat, N-His tag RG81233-NH
CEL cDNA ORF Clone, Rat, C-HA tag RG81233-CY
CEL cDNA ORF Clone, Rat, N-HA tag RG81233-NY
CEL cDNA ORF Clone, Rat, C-Myc tag RG81233-CM
CEL cDNA ORF Clone, Rat, N-Myc tag RG81233-NM
CEL qPCR Primer Pairs, Rat RP301189

CEL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone in Cloning Vector, Mouse MG50583-M
CEL cDNA ORF Clone, Mouse, untagged MG50583-UT
CEL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50583-ACG
CEL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50583-ACGLN
CEL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50583-ACR
CEL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50583-CF
CEL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50583-NF
CEL cDNA ORF Clone, Mouse, C-His tag MG50583-CH
CEL cDNA ORF Clone, Mouse, C-HA tag MG50583-CY
CEL cDNA ORF Clone, Mouse, N-HA tag MG50583-NY
CEL cDNA ORF Clone, Mouse, C-Myc tag MG50583-CM
CEL cDNA ORF Clone, Mouse, N-Myc tag MG50583-NM
CEL qPCR Primer Pairs, Mouse MP200575

CEL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CEL cDNA ORF Clone, Human, untagged HG17918-UT
info info
添加购物车成功! 添加购物车失败!