CD37 cDNA ORF Clone, Mouse, untagged

Cat: MG50719-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CD37 Reagents

CRO Services

Product recommended


All CD37 Reagents

CD37 cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Mouse CD37 antigen.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD37 cDNA ORF Clone, Mouse, untagged Alternative Names

Tspan26 cDNA ORF Clone, Mouse

CD37 Background Information

Full Name
CD37 molecule

CD37 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CD37 cDNA ORF Clone in Cloning Vector, Rhesus CG90186-G
CD37 cDNA ORF Clone, Rhesus, untagged CG90186-UT
CD37 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90186-ACGLN
CD37 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90186-ACG
CD37 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90186-ACR
CD37 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90186-CF
CD37 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90186-NF
CD37 cDNA ORF Clone, Rhesus, C-His tag CG90186-CH
CD37 cDNA ORF Clone, Rhesus, N-His tag CG90186-NH
CD37 cDNA ORF Clone, Rhesus, C-HA tag CG90186-CY
CD37 cDNA ORF Clone, Rhesus, N-HA tag CG90186-NY
CD37 cDNA ORF Clone, Rhesus, C-Myc tag CG90186-CM
CD37 cDNA ORF Clone, Rhesus, N-Myc tag CG90186-NM

CD37 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD37 cDNA ORF Clone in Cloning Vector, Mouse MG50719-G
CD37 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50719-ACG
CD37 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50719-ACGLN
CD37 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50719-ACR
CD37 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50719-CF
CD37 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50719-NF
CD37 cDNA ORF Clone, Mouse, C-His tag MG50719-CH
CD37 cDNA ORF Clone, Mouse, N-His tag MG50719-NH
CD37 cDNA ORF Clone, Mouse, C-HA tag MG50719-CY
CD37 cDNA ORF Clone, Mouse, N-HA tag MG50719-NY
CD37 cDNA ORF Clone, Mouse, C-Myc tag MG50719-CM
CD37 cDNA ORF Clone, Mouse, N-Myc tag MG50719-NM
CD37 qPCR Primer Pairs, Mouse MP200694

CD37 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD37 cDNA ORF Clone in Cloning Vector, Human HG11000-M
CD37 cDNA ORF Clone, Human, untagged HG11000-UT
CD37 cDNA ORF Clone, Human, C-GFPSpark® tag HG11000-ACG
CD37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11000-ACGLN
CD37 cDNA ORF Clone, Human, C-OFPSpark® tag HG11000-ACR
CD37 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11000-CF
CD37 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11000-NF
CD37 cDNA ORF Clone, Human, C-His tag HG11000-CH
CD37 cDNA ORF Clone, Human, N-His tag HG11000-NH
CD37 cDNA ORF Clone, Human, C-HA tag HG11000-CY
CD37 cDNA ORF Clone, Human, N-HA tag HG11000-NY
CD37 cDNA ORF Clone, Human, C-Myc tag HG11000-CM
CD37 cDNA ORF Clone, Human, N-Myc tag HG11000-NM
CD37 qPCR Primer Pairs, Human HP100962
info info
添加购物车成功! 添加购物车失败!