After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus CD19/B4/CVID3 Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse CD19 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_009844.2
cDNA-Größe:1644bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus CD19 antigen with C terminal HA tag.
Synonyme für Gene:AW495831, Cd19
Spezies:Mouse
Vektor:pCMV3-C-HA
Plasmid:pCMV3-mCD19-HA
Restriktionsschnittstelle:HindIII + XbaI (6kb + 1.69kb)
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD19 Gene Plasmid Map
Mouse CD19 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Hintergrund

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

Referenzen
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.
  • Size / Price
    Katalog: MG50510-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Mouse CD19 ORF mammalian expression plasmid, C-HA tag
    • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5622
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“