CCL28 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

CCL28 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 28 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL28 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

CCK1 cDNA ORF Clone, Mouse; MEC cDNA ORF Clone, Mouse; Scya28 cDNA ORF Clone, Mouse

CCL28 Background Information

CCL28 chemokine is expressed by epithelial cells of various mucosal tissues. This chemokine binds to CCR3 and CCR1 receptors and plays an essential role in the IgA antibody secreting cells (IgA-ASC) homing to mucosal surfaces and to lactating mammary gland as well. In addition, CCL28 has been shown to exert a potent antimicrobial activity against both Gram-negative and Gram-positive bacteria and fungi. The potent antimicrobial function of CCL28 combined with its wide distribution in mucosal tissues and secretions suggest that this protein plays an important role in innate immune protection of the epithelial surfaces. CCL28 is a human chemokine constitutively expressed by epithelial cells in diverse mucosal tissues and is known to attract a variety of immune cell types including T-cell subsets and eosinophils. Elevated levels of CCL28 have been found in the airways of individuals with asthma, and previous studies have indicated that CCL28 plays a vital role in the acute development of post-viral asthma. CCL28 presents a novel target for the development of alternative asthma therapeutics. The dental decay of children leads to the secretion of chemokine CCL28, which promotes the secretion of sIgA in saliva. CC chemokine ligand28 (CCL28) has been reported as a severity marker in atopic dermatitis.
Full Name
chemokine (C-C motif) ligand 28
Add to Cart Successfully Add to Cart Failed