CCL28 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50107-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CCL28 Reagents

CRO Services

Product recommended


All CCL28 Reagents

CCL28 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 28 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL28 cDNA ORF Clone, Mouse, N-His tag Alternative Names

CCK1 cDNA ORF Clone, Mouse;MEC cDNA ORF Clone, Mouse;Scya28 cDNA ORF Clone, Mouse

CCL28 Background Information

CCL28 chemokine is expressed by epithelial cells of various mucosal tissues. This chemokine binds to CCR3 and CCR1 receptors and plays an essential role in the IgA antibody secreting cells (IgA-ASC) homing to mucosal surfaces and to lactating mammary gland as well. In addition, CCL28 has been shown to exert a potent antimicrobial activity against both Gram-negative and Gram-positive bacteria and fungi. The potent antimicrobial function of CCL28 combined with its wide distribution in mucosal tissues and secretions suggest that this protein plays an important role in innate immune protection of the epithelial surfaces. CCL28 is a human chemokine constitutively expressed by epithelial cells in diverse mucosal tissues and is known to attract a variety of immune cell types including T-cell subsets and eosinophils. Elevated levels of CCL28 have been found in the airways of individuals with asthma, and previous studies have indicated that CCL28 plays a vital role in the acute development of post-viral asthma. CCL28 presents a novel target for the development of alternative asthma therapeutics. The dental decay of children leads to the secretion of chemokine CCL28, which promotes the secretion of sIgA in saliva. CC chemokine ligand28 (CCL28) has been reported as a severity marker in atopic dermatitis.
Full Name
chemokine (C-C motif) ligand 28

CCL28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCL28 cDNA ORF Clone in Cloning Vector, Mouse MG50107-M
CCL28 cDNA ORF Clone, Mouse, untagged MG50107-UT
CCL28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50107-ACGLN
CCL28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50107-ACG
CCL28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50107-ACR
CCL28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50107-CF
CCL28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50107-NF
CCL28 cDNA ORF Clone, Mouse, C-His tag MG50107-CH
CCL28 cDNA ORF Clone, Mouse, C-HA tag MG50107-CY
CCL28 cDNA ORF Clone, Mouse, N-HA tag MG50107-NY
CCL28 cDNA ORF Clone, Mouse, C-Myc tag MG50107-CM
CCL28 cDNA ORF Clone, Mouse, N-Myc tag MG50107-NM
CCL28 qPCR Primer Pairs, Mouse MP200137

CCL28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCL28 cDNA ORF Clone in Cloning Vector, Human HG10618-M
CCL28 cDNA ORF Clone, Human, untagged HG10618-UT
CCL28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10618-ACGLN
CCL28 cDNA ORF Clone, Human, C-GFPSpark® tag HG10618-ACG
CCL28 cDNA ORF Clone, Human, C-OFPSpark® tag HG10618-ACR
CCL28 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10618-CF
CCL28 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10618-NF
CCL28 cDNA ORF Clone, Human, C-His tag HG10618-CH
CCL28 cDNA ORF Clone, Human, N-His tag HG10618-NH
CCL28 cDNA ORF Clone, Human, C-HA tag HG10618-CY
CCL28 cDNA ORF Clone, Human, N-HA tag HG10618-NY
CCL28 cDNA ORF Clone, Human, C-Myc tag HG10618-CM
CCL28 cDNA ORF Clone, Human, N-Myc tag HG10618-NM
CCL28 qPCR Primer Pairs, Human HP100599
info info
添加购物车成功! 添加购物车失败!