Schnelle Bestellung

Maus C1QL1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus C1QL1 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_011795.2
    cDNA-Größe:777bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus complement component 1, q subcomponent-like 1 with C terminal His tag.
    Synonyme für Gene:CRF, C1qrf, CTRP14, gliacolin
    Spezies:Mouse
    Vektor:pCMV3-C-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with C1QL1 qPCR primers for gene expression analysis, MP201601 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Size / Price
    Katalog: MG51728-CH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“