Schnelle Bestellung

Maus Ctip1/BCL11A Gene ORF cDNA clone expression plasmid, N-His tag

  • Human PKM2 Gene Plasmid Map 5788
DatenblattBewertungenÄhnliche ProdukteProtokolle
Maus BCL11A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001159290.1
cDNA-Größe:621 bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) with N terminal His tag.
Synonyme für Gene:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Spezies:Mouse
Vektor:pCMV3-N-His
Plasmid:PCMV3-His-mBCL11A
Restriktionsschnittstelle:KpnI + NotI(6kb+0.62kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BCL11A qPCR primers for gene expression analysis, MP202424 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Katalog: MG52551-NH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“