ICOS ligand cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

ICOS ligand cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
969 bp
Description
Full length Clone DNA of Mouse icos ligand with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ICOS ligand cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

B7-H2 cDNA ORF Clone, Mouse; B7h cDNA ORF Clone, Mouse; B7RP-1 cDNA ORF Clone, Mouse; GI50 cDNA ORF Clone, Mouse; GL50 cDNA ORF Clone, Mouse; GL50-B cDNA ORF Clone, Mouse; ICOS-L cDNA ORF Clone, Mouse; Icoslg cDNA ORF Clone, Mouse; LICOS cDNA ORF Clone, Mouse

ICOS ligand Background Information

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.
Full Name
inducible T-cell co-stimulator ligand
References
  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.

ICOS ligand cDNA ORF Clone, Rat, Related Products

ICOS ligand cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后