CD57 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50723-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CD57 Reagents

CRO Services

Product recommended


All CD57 Reagents

CD57 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD57 cDNA ORF Clone, Mouse, N-His tag Alternative Names

0710007K08Rik cDNA ORF Clone, Mouse;AI846286 cDNA ORF Clone, Mouse;GlcAT-P cDNA ORF Clone, Mouse;Glcatp cDNA ORF Clone, Mouse;Hnk1 cDNA ORF Clone, Mouse

CD57 Background Information

B3GAT1 is the key enzyme during the biosynthesis of the carbohydrate epitope HNK-1, which is present on a number of cell adhesion molecules important in neurodevelopment. Saturating concentrations of rVAR2 inhibited downstream integrin signaling, which was mimicked by knockdown of the core chondroitin sulfate synthesis enzymes β-1,3-glucuronyltransferase 1 (B3GAT1) and chondroitin sulfate N-acetylgalactosaminyltransferase 1 (CSGALNACT1).
Full Name
beta-1,3-glucuronyltransferase 1

CD57 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD57 cDNA ORF Clone in Cloning Vector, Rat RG80108-G
CD57 cDNA ORF Clone, Rat, untagged RG80108-UT
CD57 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80108-ACGLN
CD57 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80108-ACG
CD57 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80108-ACR
CD57 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80108-CF
CD57 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80108-NF
CD57 cDNA ORF Clone, Rat, C-His tag RG80108-CH
CD57 cDNA ORF Clone, Rat, N-His tag RG80108-NH
CD57 cDNA ORF Clone, Rat, C-HA tag RG80108-CY
CD57 cDNA ORF Clone, Rat, N-HA tag RG80108-NY
CD57 cDNA ORF Clone, Rat, C-Myc tag RG80108-CM
CD57 cDNA ORF Clone, Rat, N-Myc tag RG80108-NM
CD57 qPCR Primer Pairs, Rat RP300103

CD57 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD57 cDNA ORF Clone in Cloning Vector, Mouse MG50723-G
CD57 cDNA ORF Clone, Mouse, untagged MG50723-UT
CD57 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50723-ACG
CD57 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50723-ACGLN
CD57 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50723-ACR
CD57 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50723-CF
CD57 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50723-NF
CD57 cDNA ORF Clone, Mouse, C-His tag MG50723-CH
CD57 cDNA ORF Clone, Mouse, C-HA tag MG50723-CY
CD57 cDNA ORF Clone, Mouse, N-HA tag MG50723-NY
CD57 cDNA ORF Clone, Mouse, C-Myc tag MG50723-CM
CD57 cDNA ORF Clone, Mouse, N-Myc tag MG50723-NM
CD57 qPCR Primer Pairs, Mouse MP200698

CD57 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD57 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18529-CF
info info
添加购物车成功! 添加购物车失败!