Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50299-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Angiopoietin-like 7 Reagents

CRO Services

Product recommended


All Angiopoietin-like 7 Reagents

Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Mouse angiopoietin-like 7 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-like 7 Background Information

ANGPTL7 is a member of the Angiopoietin-like (ANGPTL) protein family that is composed of eight proteins (1-8). Increasing evidence is associating ANGPTL proteins to obesity and insulin resistance. Obesity increases the level of ANGPTL7 in both plasma and adipose tissue. Increased expression of ANGPTL7 might play a minor role in the regulation of TG level in obese subjects either directly or through interaction with other ANGPTL protein members. Physical exercise reduced the level of ANGPTL7 highlighting the potential for targeting this protein as a therapeutic target for regulating dyslipidemia. Angptl7 is a factor that promotes pro-inflammatory responses in macrophages through the P38 MAPK signaling pathway and represents a potential therapeutic target for treatment of inflammatory diseases. Expression of ANGPTL7 (angiopoietin-like 7), a protein not previously linked to metastasis, was highly up-regulated in cancer cells after myeloid cell depletion. This effect was duplicated in tissue culture, where coculture of cancer cells with tumor-conditioned myeloid cells from liver metastases or myeloid cell conditioned media down-regulated ANGPTL7 expression. Analogous to myeloid cell depletion, overexpression of ANGPTL7 in cancer cells significantly reduced hepatic metastasis formation and angiogenesis. We found that ANGPTL7 itself has strong antiangiogenic effects in vitro. Furthermore, analysis of The Cancer Genome Atlas colorectal and breast cancer data sets revealed striking ANGPTL7 underexpression in cancerous compared to normal tissues. Also, ANGPTL7 was down-regulated in metastatic liver colonies of colorectal cancer patients compared to their adjacent liver tissue.The secreted growth factor ANGPTL7 as a regulator of both human hematopoietic stem and progenitor cell expansion and regeneration.
Full Name
angiopoietin-like 7

Angiopoietin-like 7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Rhesus CG90028-G
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, untagged CG90028-UT
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90028-ACG
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90028-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90028-ACR
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90028-CF
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90028-NF
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-His tag CG90028-CH
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-His tag CG90028-NH
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-HA tag CG90028-CY
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-HA tag CG90028-NY
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-Myc tag CG90028-CM
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-Myc tag CG90028-NM

Angiopoietin-like 7 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Canine DG70030-G
Angiopoietin-like 7 cDNA ORF Clone, Canine, untagged DG70030-UT
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70030-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70030-ACG
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70030-ACR
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70030-CF
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70030-NF
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-His tag DG70030-CH
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-His tag DG70030-NH
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-HA tag DG70030-CY
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-HA tag DG70030-NY
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-Myc tag DG70030-CM
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-Myc tag DG70030-NM

Angiopoietin-like 7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Mouse MG50299-M
Angiopoietin-like 7 cDNA ORF Clone, Mouse, untagged MG50299-UT
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50299-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50299-ACG
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50299-ACR
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50299-CF
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-His tag MG50299-CH
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-His tag MG50299-NH
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-HA tag MG50299-CY
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-HA tag MG50299-NY
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-Myc tag MG50299-CM
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-Myc tag MG50299-NM
Angiopoietin-like 7 qPCR Primer Pairs, Mouse MP200322

Angiopoietin-like 7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Human HG12294-G
Angiopoietin-like 7 cDNA ORF Clone, Human, untagged HG12294-UT
Angiopoietin-like 7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12294-ACG
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12294-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12294-ACR
Angiopoietin-like 7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12294-CF
Angiopoietin-like 7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12294-NF
Angiopoietin-like 7 cDNA ORF Clone, Human, C-His tag HG12294-CH
Angiopoietin-like 7 cDNA ORF Clone, Human, N-His tag HG12294-NH
Angiopoietin-like 7 cDNA ORF Clone, Human, C-HA tag HG12294-CY
Angiopoietin-like 7 cDNA ORF Clone, Human, N-HA tag HG12294-NY
Angiopoietin-like 7 cDNA ORF Clone, Human, C-Myc tag HG12294-CM
Angiopoietin-like 7 cDNA ORF Clone, Human, N-Myc tag HG12294-NM
Angiopoietin-like 7 qPCR Primer Pairs, Human HP101904
info info
添加购物车成功! 添加购物车失败!