After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus ATF2 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse ATF2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001025093.1
cDNA-Größe:1464bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus activating transcription factor 2, isfrom 1.
Synonyme für Gene:mXBP, Atf-2, Creb2, CRE-BP, D18875, MGC105211, MGC105222, D130078H02Rik, Tg(Gzma-Klra1)7Wum, Atf2
Spezies:Mouse
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 

Referenzen
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • Size / Price
    Katalog: MG50262-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“