ANKRD16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

ANKRD16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1086 bp
Description
Full length Clone DNA of Mouse ankyrin repeat domain 16 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ANKRD16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

2810455F06Rik cDNA ORF Clone, Mouse; AI646698 cDNA ORF Clone, Mouse; D430029B21Rik cDNA ORF Clone, Mouse

ANKRD16 Background Information

Full Name
ankyrin repeat domain 16
Add to Cart Successfully Add to Cart Failed