After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse ALOX5AP Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_009663.1
cDNA-Größe:486bp
cDNA-Beschreibung:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal His tag.
Synonyme für Gene:Flap
Spezies:Mouse
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52815-ACG$225
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52815-ACR$225
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52815-ANG$225
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52815-ANR$225
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Flag tagMG52815-CF$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-His tagMG52815-CH$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Myc tagMG52815-CM$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-HA tagMG52815-CY$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone in cloning vectorMG52815-G$75
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Flag tagMG52815-NF$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tagMG52815-NH$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Myc tagMG52815-NM$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-HA tagMG52815-NY$195
Maus ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmidMG52815-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

Referenzen
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Katalog: MG52815-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“