Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1092 bp
Description
Full length Clone DNA of Mouse aldolase C, fructose-bisphosphate with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aldolase C/ALDOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

AI847350 cDNA ORF Clone, Mouse; Aldo3 cDNA ORF Clone, Mouse; AU040929 cDNA ORF Clone, Mouse; Scrg2 cDNA ORF Clone, Mouse

Aldolase C/ALDOC Background Information

Full Name
aldolase C, fructose-bisphosphate
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait