AJAP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52275-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All AJAP1 Reagents

CRO Services

Product recommended


All AJAP1 Reagents

AJAP1 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Mouse adherens junction associated protein 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AJAP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names

Gm573 cDNA ORF Clone, Mouse

AJAP1 Background Information

Full Name
adherens junctions associated protein 1

AJAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52275-G
AJAP1 cDNA ORF Clone, Mouse, untagged MG52275-UT
AJAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACGLN
AJAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACG
AJAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52275-ACR
AJAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52275-CF
AJAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52275-NF
AJAP1 cDNA ORF Clone, Mouse, C-His tag MG52275-CH
AJAP1 cDNA ORF Clone, Mouse, C-HA tag MG52275-CY
AJAP1 cDNA ORF Clone, Mouse, N-HA tag MG52275-NY
AJAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52275-CM
AJAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52275-NM
AJAP1 qPCR Primer Pairs, Mouse MP202148

AJAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Human HG13392-G
AJAP1 cDNA ORF Clone, Human, untagged HG13392-UT
AJAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACG
AJAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACGLN
AJAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13392-ACR
AJAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13392-CF
AJAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13392-NF
AJAP1 cDNA ORF Clone, Human, C-His tag HG13392-CH
AJAP1 cDNA ORF Clone, Human, N-His tag HG13392-NH
AJAP1 cDNA ORF Clone, Human, C-HA tag HG13392-CY
AJAP1 cDNA ORF Clone, Human, N-HA tag HG13392-NY
AJAP1 cDNA ORF Clone, Human, C-Myc tag HG13392-CM
AJAP1 cDNA ORF Clone, Human, N-Myc tag HG13392-NM
AJAP1 qPCR Primer Pairs, Human HP102096
info info
添加购物车成功! 添加购物车失败!