ACADVL cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51457-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ACADVL Reagents

CRO Services

Product recommended


All ACADVL Reagents

ACADVL cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1971 bp
Description
Full length Clone DNA of Mouse acyl-Coenzyme A dehydrogenase, very long chain with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADVL cDNA ORF Clone, Mouse, N-HA tag Alternative Names

vlcad cDNA ORF Clone, Mouse

ACADVL Background Information

Full Name
acyl-CoA dehydrogenase, very long chain

ACADVL cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ACADVL cDNA ORF Clone in Cloning Vector, Cynomolgus CG90837-G
ACADVL cDNA ORF Clone, Cynomolgus, untagged CG90837-UT
ACADVL cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90837-ACG
ACADVL Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90837-ACGLN
ACADVL cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90837-ANG
ACADVL cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90837-ACR
ACADVL cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90837-ANR
ACADVL cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90837-CF
ACADVL cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90837-NF
ACADVL cDNA ORF Clone, Cynomolgus, C-His tag CG90837-CH
ACADVL cDNA ORF Clone, Cynomolgus, N-His tag CG90837-NH
ACADVL cDNA ORF Clone, Cynomolgus, C-HA tag CG90837-CY
ACADVL cDNA ORF Clone, Cynomolgus, N-HA tag CG90837-NY
ACADVL cDNA ORF Clone, Cynomolgus, C-Myc tag CG90837-CM
ACADVL cDNA ORF Clone, Cynomolgus, N-Myc tag CG90837-NM

ACADVL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADVL cDNA ORF Clone in Cloning Vector, Mouse MG51457-G
ACADVL cDNA ORF Clone, Mouse, untagged MG51457-UT
ACADVL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51457-ACGLN
ACADVL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51457-ACG
ACADVL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51457-ANG
ACADVL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51457-ACR
ACADVL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51457-ANR
ACADVL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51457-CF
ACADVL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51457-NF
ACADVL cDNA ORF Clone, Mouse, C-His tag MG51457-CH
ACADVL cDNA ORF Clone, Mouse, N-His tag MG51457-NH
ACADVL cDNA ORF Clone, Mouse, C-HA tag MG51457-CY
ACADVL cDNA ORF Clone, Mouse, C-Myc tag MG51457-CM
ACADVL cDNA ORF Clone, Mouse, N-Myc tag MG51457-NM
ACADVL qPCR Primer Pairs, Mouse MP201341

ACADVL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADVL cDNA ORF Clone in Cloning Vector, Human HG11348-M
ACADVL cDNA ORF Clone, Human, untagged HG11348-UT
ACADVL cDNA ORF Clone, Human, C-GFPSpark® tag HG11348-ACG
ACADVL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11348-ACGLN
ACADVL cDNA ORF Clone, Human, N-GFPSpark® tag HG11348-ANG
ACADVL cDNA ORF Clone, Human, C-OFPSpark® tag HG11348-ACR
ACADVL cDNA ORF Clone, Human, N-OFPSpark® tag HG11348-ANR
ACADVL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11348-CF
ACADVL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11348-NF
ACADVL cDNA ORF Clone, Human, C-His tag HG11348-CH
ACADVL cDNA ORF Clone, Human, N-His tag HG11348-NH
ACADVL cDNA ORF Clone, Human, C-HA tag HG11348-CY
ACADVL cDNA ORF Clone, Human, N-HA tag HG11348-NY
ACADVL cDNA ORF Clone, Human, C-Myc tag HG11348-CM
ACADVL cDNA ORF Clone, Human, N-Myc tag HG11348-NM
ACADVL qPCR Primer Pairs, Human HP101233
info info
添加购物车成功! 添加购物车失败!