Schnelle Bestellung

Maus ABHD4 Gene ORF cDNA clone expression plasmid, N-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Maus ABHD4 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001205181.1
    cDNA-Größe:957bp
    cDNA-Beschreibung:Full length Clone DNA of Mus musculus abhydrolase domain containing 4 with N terminal His tag.
    Synonyme für Gene:Abh4, AI429574, 1110035H23Rik, Abhd4
    Spezies:Mouse
    Vektor:pCMV3-N-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ABHD4 qPCR primers for gene expression analysis, MP200722 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Hintergrund

    Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.

    Referenzen
  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
  • Size / Price
    Katalog: MG50747-NH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“