Schnelle Bestellung

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
DatenblattBewertungenÄhnliche ProdukteProtokolle
MERS-CoV CoV-orf4b Produktinformation zum cDNA-Klon
Gene_bank_ref_id:JX869059.2
cDNA-Größe:783 bp
cDNA-Beschreibung:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with C terminal HA tag.
Synonyme für Gene:CoV-orf4b
Spezies:MERS-CoV
Vektor:pCMV3-C-HA
Plasmid:pCMV3-NS3C-HA
Restriktionsschnittstelle:KpnI + XbaI(6kb+0.78kb)
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank AFS88939.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag on other vectors
Product nameProduct name
Size / Price
Katalog: VG40084-CY
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“