After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse KDR/VEGFR2/CD309 Produktinformation zum cDNA-Klon
Synonyme für Gene:
Mouse KDR/VEGFR2/CD309 Gene Plasmid Map
Mouse KDR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.
  • Contact Us
    • Mouse KDR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.