After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
H9N2 NA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:1404bp
cDNA-Beschreibung:Full length Clone DNA of Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase with N terminal His tag.
Synonyme für Gene:Neuraminidase, NA
Spezies:H9N2
Vektor:pCMV3-SP-N-His
Plasmid:pCMV3-His-H9N2-HK-99-NA
Restriktionsschnittstelle:HindIII + XbaI (6kb + 1.49kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_859038.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
H9N2 NA Gene Plasmid Map
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40040-ACG$325
Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40040-ACR$325
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40040-CF$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40040-CH$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40040-CM$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40040-CY$295
Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized)VG40040-G$95
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40040-NF$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40040-NH$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40040-NM$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40040-NY$295
Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized)VG40040-UT$295
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“