After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
H9N2 HA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:1683bp
cDNA-Beschreibung:Full length Clone DNA of Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin with N terminal His tag.
Synonyme für Gene:Hemagglutinin, HA
Spezies:H9N2
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADC41863.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40178-ACG$345
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40178-ACR$345
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40178-CF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40178-CH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40178-CM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40178-CY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40178-NF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40178-NH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40178-NM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40178-NY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized)VG40178-UT$315
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Referenzen
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Katalog: VG40178-NH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“