After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
H5N1 HA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:1707bp
cDNA-Beschreibung:Full length Clone DNA of Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin with C terminal HA tag.
Synonyme für Gene:Hemagglutinin, HA
Spezies:H5N1
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFF60787.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40065-ACG$345
Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40065-ACR$345
Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40065-C$395
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40065-CF$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40065-CH$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40065-CM$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40065-CY$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40065-NF$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40065-NH$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40065-NM$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40065-NY$315
Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40065-UT$315
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: VG40065-CY
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit2-3 weeksAnweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“