Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

Cat: VG40025-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Hemagglutinin / HA Reagents
CRO Services
Product recommended

All Hemagglutinin / HA Reagents
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) General Information
Gene
Species
H4N8
RefSeq ORF Size
1695 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Description
Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hemagglutinin / HA Background Information

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Full Name
Harvey rat sarcoma viral oncogene homolog
References
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Hemagglutinin / HA cDNA ORF Clone, Influenza B, Related Products

    Product Name Catalog#(PDF)
    Influenza B (B/Victoria/504/2000) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40391-G
    Influenza B (B/Ohio/01/2005) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40460-UT
    Influenza B (B/Utah/02/2012) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40463-UT
    Influenza B (B/Hubei Wujigang/158/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40505-G-N
    Influenza B (B/Jilin/20/2003) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40513-ACGLN
    Influenza B (B/Florida/07/2004) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40432-ACGLN
    Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11716-CF
    Influenza B (B/Victoria/504/2000) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40391-NH
    Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11716-CY
    Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40016-CM

    Hemagglutinin / HA cDNA ORF Clone, H5N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N1 (A/Vietnam/UT31413II/2008) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG40022-G
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11697-UT
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11694-UT
    Influenza A H5N1 (A/duck/Laos/3295/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11701-UT
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmid VG40004-C
    Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG11062-UT
    Influenza A H5N1 (A/Cambodia/R0405050/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11710-UT
    Influenza A H5N1 (Cambodia/S1211394/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40026-UT
    Influenza A H5N1 (A/Vietnam/UT31413II/2008) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40022-ACG
    Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression ready VG40001-ACG
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression ready VG40004-ACG
    Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11702-ACGLN
    Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40065-ACGLN
    Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11700-ACGLN
    Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11062-ACGLN
    Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40088-ACGLN
    Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11712-ACR
    Influenza A H5N1 (A/Egypt/3300-NAMRU3/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40049-ACR
    Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40088-ACR
    Influenza A H5N1 (A/Cambodia/S1211394/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40026-ACR
    Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40001-ACR
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11697-ACR
    Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11712-CF
    Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40088-CF
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40060-CF
    Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11062-CF
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40065-CF
    Influenza A H5N1 (bar-headed goose/Qinghai/1A/2005) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40117-NF
    Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag tag VG40001-NF
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Flag tag, expression ready VG40004-NF
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11694-NF
    Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11690-NF
    Influenza A H5N1 (A/Hong Kong/483/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11689-NF
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11686-NF
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11686-CH
    Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11709-CH
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40065-CH
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40060-CH
    Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40088-CH
    Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11698-CH
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11686-NH
    Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11700-NH
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11686-CY
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11694-CY
    Influenza A H5N1 (Egypt/3300-NAMRU3/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40049-CY
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression ready VG40004-NY
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40065-NY
    Influenza A H5N1 (bar-headed goose/Qinghai/1A/2005) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40117-NY
    Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11709-CM
    Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11686-CM
    Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11712-CM
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression ready VG40004-CM
    Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11702-NM
    Influenza A H5N1 (A/Hong Kong/483/97) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11689-NM
    Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11694-NM
    Influenza A H5N1 (Hubei/1/2010) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40060-NM

    Hemagglutinin / HA cDNA ORF Clone, H6N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40397-UT
    Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11723-UT
    Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11723-CF
    Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11723-CH
    Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40397-CY

    Hemagglutinin / HA cDNA ORF Clone, H5N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N8 (A/turkey/Germany-MV/R2472/2014) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40512-UT
    Influenza A H5N8 (A/duck/Jiangsu/k1203/2010) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40385-G-N
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11717-UT
    Influenza A H5N8 (A/Chicken/Netherlands/14015526/2014) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40511-ACGLN
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11717-CY
    Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11717-NM

    Hemagglutinin / HA cDNA ORF Clone, H1N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N1 (A/Mexico/InDRE4114/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40510-UT
    Influenza A H1N1 (A/Memphis/1/1987) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40509-G-N
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40393-UT
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11708-UT
    Influenza A H1N1 (A/Taiwan/01/1986) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40131-G-N
    Influenza A H1N1 (A/Albany/12/1951) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40464-UT
    Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11684-UT
    Influenza A H1N1 (A/California/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG11085-UT
    Influenza A H1N1 (A/Ohio/UR06-0091/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11687-UT
    Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40035-ACG
    Influenza A H1N1 (A/Brisbane/59/2007) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11052-ACGLN
    Influenza A H1N1 (A/swine/Belgium/1/1998) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40393-ACG
    Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40035-ACR
    Influenza A H1N1 (A/NewJersey/8/1976) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40392-ACR
    Influenza A H1N1 (A/Texas/05/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40006-ACR
    Influenza A H1N1 (A/Swine/Wisconsin/136/1997) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40394-CF
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11683-CF
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40005-CF
    Influenza A H1N1 (Texas/05/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40006-CF
    Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40007-CF
    Influenza A H1N1 (Texas/05/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40006-NF
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11708-NF
    Influenza A H1N1 (Texas/05/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40006-NH
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11708-NH
    Influenza A H1N1 (A/Swine/Wisconsin/136/1997) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40394-CY
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11683-CY
    Influenza A H1N1 (A/Solomon Islands/3/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11708-NY
    Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40035-NY
    Influenza A H1N1 (A/Ohio/UR06-0091/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11687-NY
    Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11684-CM
    Influenza A H1N1 (A/NewJersey/8/1976) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40392-CM
    Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11683-NM
    Influenza A H1N1 (England/195/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40005-NM

    Hemagglutinin / HA cDNA ORF Clone, H10N7, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N7 (A/blue-winged teal/Louisiana/Sg-00073/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40433-G-N

    Hemagglutinin / HA cDNA ORF Clone, H3N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H3N2 (A/Indiana/07/2012) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40395-UT
    Influenza A H3N2 (A/Fujian/411/2002) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40120-G-N
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG40116-UT
    Influenza A H3N2 (A/Moscow/10/1999) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40154-UT
    Influenza A H3N2 (A/Netherlands/178/1995) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40486-ACGLN
    Influenza A H3N2 (A/Victoria/3/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40396-ACG
    Influenza A H3N2 (A/Perth/16/2009) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40043-ACGLN
    Influenza A H3N2 (A/Aichi/2/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11707-ACG
    Influenza A H3N2 (A/Wyoming/3/03) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11715-ACR
    Influenza A H3N2 (A/Aichi/2/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11707-NF
    Influenza A H3N2 (A/Indiana/07/2012) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40395-CH
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40116-NH
    Influenza A H3N2 (A/Aichi/2/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11707-CY
    Influenza A H3N2 (A/Wisconsin/67/2005) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11972-NY
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40116-NY
    Influenza A H3N2 (A/Victoria/3/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40396-NY
    Influenza A H3N2 (A/Wyoming/3/03) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11715-CM
    Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40116-NM
    Influenza A H3N2 (A/Aichi/2/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11707-NM

    Hemagglutinin / HA cDNA ORF Clone, H6N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N8 (A/mallard/Ohio/217/1998) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40168-G-N

    Hemagglutinin / HA cDNA ORF Clone, H10N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40351-UT

    Hemagglutinin / HA cDNA ORF Clone, H7N9, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N9 (A/Zhejiang/DTID-ZJU10/2013) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40325-G-N
    Influenza A H7N9 (A/Pigeon/Shanghai/S1069/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG40106-UT
    Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40104-ACG
    Influenza A H7N9 (A/Huzhou/10/2013) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40356-ACGLN
    Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-HA tag VG40104-CY
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40103-CY
    Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40103-CM

    Hemagglutinin / HA cDNA ORF Clone, H13N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H13N6 (A/black-headed gull/Sweden/1/1999) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40190-G-N

    Hemagglutinin / HA cDNA ORF Clone, H9N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H9N1 (A/duck/NZL/76/1984) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40179-UT

    Hemagglutinin / HA cDNA ORF Clone, H9N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H9N2 (A/Hong Kong/35820/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40174-UT
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11719-ACR
    Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40178-CH
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11719-CM
    Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40178-NM

    Hemagglutinin / HA cDNA ORF Clone, H5N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N3 (A/duck/Hokkaido/167/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11696-UT
    Influenza A H5N3 (A/duck/Hokkaido/167/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11696-NY

    Hemagglutinin / HA cDNA ORF Clone, H15N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H15N8 (A/duck/AUS/341/1983) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) VG11720-UT
    Influenza A H15N8 (A/duck/AUS/341/1983) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11720-CH
    Influenza A H15N8 (A/duck/AUS/341/1983) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11720-NM

    Hemagglutinin / HA cDNA ORF Clone, H10N9, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N9 (A/duck/Hong Kong/562/1979) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40028-UT

    Hemagglutinin / HA cDNA ORF Clone, H11N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40187-G-N

    Hemagglutinin / HA cDNA ORF Clone, H7N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N2 (A/ruddy turnstone/New Jersey/563/2006) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40170-G-N

    Hemagglutinin / HA cDNA ORF Clone, H1N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N8 (A/Egyptian goose/South Africa/AI1448/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40135-UT

    Hemagglutinin / HA cDNA ORF Clone, H2N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H2N3 (A/swine/Missouri/4296424/2006) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40138-UT

    Hemagglutinin / HA cDNA ORF Clone, H2N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H2N8 (A/herring gull/DE/703/1988) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) VG40139-UT

    Hemagglutinin / HA cDNA ORF Clone, H4N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40025-ACG
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40025-CH
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40025-CY

    Hemagglutinin / HA cDNA ORF Clone, H5N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N6 (A/duck/Jiangxi/95/2014) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40466-ACGLN
    Influenza A H5N6 (A/duck/Guangdong/GD01/2014 ) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40465-ACGLN

    Hemagglutinin / HA cDNA ORF Clone, H4N4, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin / HA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40008-ACGLN
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40008-ACR
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40008-NY

    Hemagglutinin / HA cDNA ORF Clone, H12N5, Related Products

    Product Name Catalog#(PDF)
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11718-ACGLN

    Hemagglutinin / HA cDNA ORF Clone, H4N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40390-ACG
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40390-NF
    Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40390-CY

    Hemagglutinin / HA cDNA ORF Clone, H4N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N6 (A/mallard/Ohio/657/2002) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11714-ACGLN
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11706-CF
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11706-CY
    Influenza A H4N6 (A/mallard/Ohio/657/2002) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11714-NY
    Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11706-NY

    Hemagglutinin / HA cDNA ORF Clone, H1N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N3 (A/duck/NZL/160/1976) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11685-ACGLN
    Influenza A H1N3 (A/duck/NZL/160/1976) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11685-ACG

    Hemagglutinin / HA cDNA ORF Clone, H7N7, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N7 (A/chicken/Netherlands/1/03) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11212-ACGLN
    Influenza A H7N7 (A/Netherlands/219/03) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11082-NF

    Hemagglutinin / HA cDNA ORF Clone, H10N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11693-ACGLN
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11693-ACG
    Influenza A H10N3 (A/duck/Hong Kong/786/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11693-NY

    Hemagglutinin / HA cDNA ORF Clone, H16N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H16N3 (A/black-headed gull/Sweden/5/99) Hemagglutinin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11711-ACGLN
    Influenza A H16N3 (A/black-headed gull/Sweden/5/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG11711-CY
    Influenza A H16N3 (A/black-headed gull/Sweden/5/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11711-NM

    Hemagglutinin / HA cDNA ORF Clone, H8N4, Related Products

    Product Name Catalog#(PDF)
    Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11722-ACG
    Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11722-CM
    Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG11722-NM

    Hemagglutinin / HA cDNA ORF Clone, H13N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11721-ACG

    Hemagglutinin / HA cDNA ORF Clone, H1N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG11703-ACG
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11703-CF
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11703-NF
    Influenza A H1N2 (A/swine/Guangxi/13/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG11703-CM

    Hemagglutinin / HA cDNA ORF Clone, H12N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H12N3 (bar headed goose/Mongolia/143/2005) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40189-NF
    Influenza A H12N3 (bar headed goose/Mongolia/143/2005) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40189-CH
    Influenza A H12N3 (bar headed goose/Mongolia/143/2005) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40189-NM

    Hemagglutinin / HA cDNA ORF Clone, H6N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40399-NF
    Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40399-CY

    Hemagglutinin / HA cDNA ORF Clone, H6N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40398-CH

    Hemagglutinin / HA cDNA ORF Clone, H5N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG11699-CH

    Hemagglutinin / HA cDNA ORF Clone, H17N10, Related Products

    Product Name Catalog#(PDF)
    Influenza A H17N10 (little yellow-shouldered bat/Guatemala/164/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40323-CM
    info info
    添加购物车成功! 添加购物车失败!