After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
H4N4 HA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:1695bp
cDNA-Beschreibung:Full length Clone DNA of Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin with N terminal His tag.
Synonyme für Gene:Hemagglutinin, HA
Spezies:H4N4
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB87495.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40008-ACG$345
Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40008-ACR$345
Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized)VG40008-C$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40008-CF$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40008-CH$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40008-CM$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40008-CY$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40008-NF$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40008-NH$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40008-NM$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40008-NY$315
Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin(HA) ORF mammalian expression plasmid (Codon Optimized)VG40008-UT$315
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: VG40008-NH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“