After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
H3N8 NA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:CY067600.1
cDNA-Größe:1413bp
cDNA-Beschreibung:Full length Clone DNA of Influenza A H3N8 (A/canine/NewYork/145353/2008) Neuraminidase with C terminal HA tag.
Synonyme für Gene:Neuraminidase, NA
Spezies:H3N8
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-GFPSpark tagVG40233-ACG$325
Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40233-ACR$325
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-Flag tagVG40233-CF$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-His tagVG40233-CH$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-Myc tagVG40233-CM$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, C-HA tagVG40233-CY$295
Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid (Codon Optimized)VG40233-G$95
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, N-Flag tagVG40233-NF$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, N-His tagVG40233-NH$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, N-Myc tagVG40233-NM$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) ORF mammalian expression plasmid, N-HA tagVG40233-NY$295
Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase(NA) natural ORF mammalian expression plasmidVG40233-UT$295
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Referenzen
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Katalog: VG40233-CY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“