Schnelle Bestellung

Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    RSV RSV-F Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:
    cDNA-Größe:1725bp
    cDNA-Beschreibung:Full length Clone DNA of Human RSV (subtype A, strain Long) Fusion glycoprotein / RSV-F with N terminal His tag.
    Synonyme für Gene:F, HRSVgp08
    Spezies:RSV
    Vektor:pCMV3-SP-N-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P12568.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40039-ACG$345
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40039-ACR$345
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40039-CF$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40039-CH$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40039-CM$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40039-CY$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40039-G$115
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40039-NF$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40039-NH$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40039-NM$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40039-NY$315
    Mensch respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40039-UT$315
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Hintergrund

    Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

    Referenzen
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Katalog: VG40039-NH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“